187. Repeated DNA Sequences

Posted 2021-03-25 wentiliangkaihua

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

Example:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Output: ["AAAAACCCCC", "CCCCCAAAAA"]

class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        List<String> res = new ArrayList();
        if(s.length() < 10) return res;
        
        Map<String, Integer> map = new HashMap();
        for(int i = 0; i < s.length() - 9; i++){
            String k = s.substring(i, i + 10);
            int value = map.getOrDefault(k, 0);
            map.put(k, value + 1);
        }
        for(Map.Entry<String, Integer> m: map.entrySet()){
            if(m.getValue() > 1){
                res.add(m.getKey());
            }
        }
        return res;
    }
}

 

 https://soulmachine.gitbooks.io/algorithm-essentials/java/bitwise-operations/repeated-dna-sequences.html